RNAfolding Error

[Virology Candidate]

Hello,

I have been experimenting with mFold and have come across an odd feature and was looking for clarification. When I fold a 140bp segment of RNA nucleotides, it appears fine. The mFold server outputs 4 possible RNA structures that I can view once I download them. These are available to download under "Download all foldings" subheader. However, I am interested in the difference in outputs following SNP mutations. Sometimes, when I change 1-3nts in the 140bp RNA, it will still allow me to download possible structures, but sometimes, it completely removes the option and the only subheader is "Output". I can no longer view Download all foldings, view ss-count information, view individual structures.

I was hoping to get some clarification as to why this is happening? Is this the software saying there were no folds it could reasonably come up with?

Any help would be appreciated and thanks in advance,
Virology Candidate

[nmarkham]

I believe your interpretation is correct — depending on the settings and the sequence, it's entirely possible that mfold would consider there to be no valid structures. (UNAFold is very similar, although not necessarily identical.)

If you include a link to results I can probably confirm that that's what happened. Alternatively Michael might know right away. (I think he's monitoring this forum, but I'm not certain.)

[Virology Candidate]

Hello,

Below I have provided the links, as well as the raw nts in case you cant view the links in the next 6 hours. As you can see, the regular RNA shows 3 different folds, but the SNP one offers nothing. Can you confirm this is the software saying there are no possible folds?

Regular: http://www.unafold.org/cgi-bin/view.cgi ... 0-15-33-06

GGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCCACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCC

SNP: http://www.unafold.org/cgi-bin/view.cgi ... 0-15-40-19
GGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCCGGCCTTCCCACAAGGTAACGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCC

Thanks,
Virology Candidate

[nmarkham]

OK, I compared the two sequences myself (grr, six hour limit!) and I think I see the issue.

For the first one, the default values for P, W and MAX mean mfold computes multiple structures — a minimum free energy structure and a sample of other, suboptimal structures.

For the second, there are no suboptimal structures that mfold outputs by default, although this could be different with other values of P (http://www.unafold.org/mfold/documentat ... hp#PERCENT) and W (http://www.unafold.org/mfold/documentat ... php#WINDOW).

Note that even in the second case, there is still an MFE structure, energy dot plot and other output. The server just leaves out some headers and links that don't add much when there's only one structure.