UNAFold

Hello,

I recently obtained the UNAFold license from Rensaeller and I noticed that there was occasionally discrepancies between this software and the IDT version found at https://www.idtdna.com/calc/analyzer. Notably, when I input this sequence: "AAAAAGAATTACACTTATCAGAAAATTCAAGTAATTC" at 25C and 150mM [Na+], I only get one structure for the licensed software (in the .fasta.ct file [not the .fasta_1.ct file]), but IDT displays 3 total structures. The first structure is the same, however I am trying to minimize non-target structures and was wondering if there has been any updates to the IDT version not found in the licensed software.

Thank you so much,
Tyler

I'm not familar with IDT's "OligoAnalyzer Tool". I didn't even know offhand that it uses UNAFold.

Assuming they are, I don't know precisely which version of UNAFold they use. It could very well not be UNAFold 4, which I assume is what you have, although I wouldn't expect any differences that are all that significant. It could also be that they used different options than you did. If IDT showed you multiple structures, I imagine they obtained them with the --mfold option; did you use that as well? If you didn't request suboptimal tracebacks in the first place, that could be an obvious and fairly uninteresting explanation.

If you're interested in replicating their results exactly, I suppose your best bet is to contact IDT and ask them exactly what version of UNAFold and what options they use.

Hope this helps!

Thank you so much for your prompt response! After doing more testing with the mFold webserver: http://www.unafold.org/mfold/applicatio ... g-form.php, I found that you were right and that the IDT website seems to use ~50% suboptimality number. Is there anyway to adjust the suboptimality using UNAFold and not mfold? I ask because I have a windows computer and thus I'm unable to setup mfold on my machine.

In general, if you want suboptimal structures, you use the "--mfold" option. Merely specifying it engages "mfold mode", where hybrid-ss-min (or hybrid-min or hybrid-intra-min, for that matter) generates a sample of suboptimal structures as well as an optimal one. However, --mfold can optionally take arguments to change things like the suboptimality percent. In particular, --mfold=50 might be what IDT is doing. See http://www.unafold.org/Dinamelt/unafold ... ss-min.php for more details about --mfold.

You (or anyone else who's interested) might also try the "Quikfold" app on this site: http://www.unafold.org/Dinamelt/applica ... ckfold.php. It generates suboptimal foldings and allows you to vary the three optional arguments to --mfold to change what sort of sample you get.

Thank you so much for your help, the --mfold option using hybrid-ss-min worked perfectly!