UNAFold

Thank you so much for your help, the --mfold option using hybrid-ss-min worked perfectly!

Thank you so much for your prompt response! After doing more testing with the mFold webserver: http://www.unafold.org/mfold/applications/dna-folding-form.php, I found that you were right and that the IDT website seems to use ~50% suboptimality number. Is there anyway to adjust the suboptimality usin...

Hello, I recently obtained the UNAFold license from Rensaeller and I noticed that there was occasionally discrepancies between this software and the IDT version found at https://www.idtdna.com/calc/analyzer. Notably, when I input this sequence: "AAAAAGAATTACACTTATCAGAAAATTCAAGTAATTC" at 25...