Hi, I'm attempting to fold the RNA p5ab using this service, and since I require the energy binding for each base pair, I'm worried about the specifics of thermodynamics. yet, when I utilize the RNA folding form found under RNA folding form Although the folding temperature of 37° is defined, I get a different value for the same temperature when I use the RNA folding form version 2.3 CCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGGGUGCUGACGG is the RNA's sequence.
and I'm also interested in folding the RNA at 25 °C, but I need to confirm the value I obtain first.
I appreciate your assistance.