The DINAMelt Server - results for GCCA

Job Parameters

Submitted at Fri 17 Apr 2026 10:21:28 AM UTC

5'-GCTGGATTTGGAGAACGTACCGGCCACTATCACTGACATCTTCGGCGCCAGCCAGGACACCCTGTCCACCGCGCTGCAGTGGCTGCTCCTCCTCTTCACC-3'
From 0°C by 1°C to 100°C as DNA
[A0] = 0.00001 M
[Na+] = 1 M, [Mg++] = 0 M (oligo mode)

Computation took 4.0 seconds (Log file)

Plots

Concentration Plot
Concentration plot
Download: Postscript PDF Text
Heat Capacity Plot Absorbance Plot
Heat capacity plot Extinction plot
Download: Postscript PDF Text Download: Postscript PDF Text
Download detailed plot: Postscript PDF Download detailed plot: Postscript PDF

Probability Dot Plots

°C

Van't Hoff Plots

View a van't Hoff plot as...
The fist time you request a plot there will be a short delay while the van't Hoff data is calculated.

Important Numbers

Tm(Conc): 81.8°C
ΔG: 41.7 kcal/mol   ΔH: 246.7 kcal/mol   ΔS: 751.1 cal/mol/K   Tm(Cp): 80.2°C
Tm(Ext2): 57.3°C

Download the entire job with all files, formatted as: tar/bzip2 tar/gzip zip
The first time you ask for an archive there may be a slight delay while it is created.